AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |
Back to Blog
10x chromium x9/27/2023 In November 2018, 10x Genomics announced expansion plans including opening a manufacturing facility in Pleasanton, California in early 2019. Four months later, 10x Genomics acquired Spatial Transcriptomics, a biotechnology company working in the field of spatial genomics. In August 2018 the company announced its first acquisition, Epinomics, a biotechnology company focused on the development of new techniques for epigenetics research. Ness left 10x Genomics in December 2016 and in 2018, Justin McAnear, Tesla's former finance chief joined the company as CFO. Prior to starting the company, Saxonov was the founding architect, and director of research and development at 23andMe. History ġ0x Genomics was founded in 2012 by Serge Saxonov, Ben Hindson and Kevin Ness to create advanced testing equipment for use in cellular biology. It was founded in 2012 by Serge Saxonov, Ben Hindson, and Kevin Ness. is an American biotechnology company that designs and manufactures gene sequencing technology used in scientific research. (4) Add Truseq Read 2 primer to sequence the UMI (top strand as template, sequence UMI, 10 cycles):ĥ'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX.10x Genomics, Inc. (3) Cluster regeneration, add Sample index sequencing primer (index2) to sequence the sample index (i5) (top strand as template, 8 cycles)::ĥ'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXX.XXXB(pA) NNNNNNNNNN AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNNNNNNNNNN ATCTCGTATGCCGTCTTCTGCTTG -3' (2) Add Cell barcode sequencing primer to sequence the cell barcode (bottom strand as template, in this case, cell barcode = i7 index, 14 cycles):ĥ'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-> Step-by-step library generation (1) mRNA capture using Beads-oligo-dT in the droplets, and reverse transcription using MMLV:ĥ'- AAGCAGTGGTATCAACGCAGAGTACATGGGXXXXXXXXXXXXXXXXXXXXXB(pA) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCGTCTTCTGCTTG -3'ģ'- TTCGTCACCATAGTTGCGTCTCATGTACCCXXXXXXXXXXXXXXXXXXXXNV(dT) TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG TAGAGCATACGGCAGAAGACGAAC -5'-|ĥ'- TCTTTCCCTACACGACGCTCTTCCGATCTXXX.XXXB(pA) AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ATCTCGTATGCCGTCTTCTGCTTG*A -3'ģ'- CGAGAAGGCTAGAXXX.XXXV(dT) TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG TAGAGCATACGGCAGAAGACGAAC -5'ģ'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNN TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAXXX.XXXV(dT) NNNNNNNNNN TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNNNNNNNNNN TAGAGCATACGGCAGAAGACGAAC -5' Illumina P7 adapter: 5'- CAAGCAGAAGACGGCATACGAGAT -3' Illumina P5 adapter: 5'- AATGATACGGCGACCACCGAGATCTACAC -3' Sample index sequencing primer (index2): 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -3' SI-PCR Primer: 5'- AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'Ĭell barcode sequencing primer (index1): 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' Truseq adapter (double stranded DNA with a T overhang): Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3' ISPCR: 5′- AAGCAGTGGTATCAACGCAGAGTACAT -3′ Template Switching Oligo (TSO): 5'- AAGCAGTGGTATCAACGCAGAGTACATrGrGrG -3' This file is copied from Cell Ranger (using Cell Ranger v2.1.0 as an example) /path/to/cellranger-2.1.0/cellranger-cs/2.1.0/tenkit/lib/python/tenkit/barcodes.īeads-oligo-dT: |-5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (T) 30VN -3' You can find out all the cell barcodes (14 bp) here: 737K-april-2014_rc.txt.gz. Based on their the v1 manual PDF and actual data, I think the information in this page is accurate. I cannot find the exact sequence information from the 10x website, so sequences shown here is based on educational guess. The Chromium Single Cell 3’ Solution v1 chemistry is obsolete and superseded by the v2 chemistry. 10x Chromium Single Cell 3' Solution v1 10x Chromium Single Cell 3' Solution v1
0 Comments
Read More
Leave a Reply. |